Review





Similar Products

p70s6k sirna (gacggggtcctcaaatgta, ccaaggtcatgtgaaacta  (Ribobio co)
90
Ribobio co p70s6k sirna (gacggggtcctcaaatgta, ccaaggtcatgtgaaacta
B3galt5 activates the mTOR pathway. (A) Immunoblot analysis of the phosphorylation of mTOR and <t>p70s6k</t> in liver extracts. The phosphorylation of mTOR and p70s6k in the indicated HCC cell lines with either b3galt5 knockdown or control siRNA (B) and with either b3galt5 overexpression or control vector (C) detected by western blotting
P70s6k Sirna (Gacggggtcctcaaatgta, Ccaaggtcatgtgaaacta, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/p70s6k+sirna++gacggggtcctcaaatgta++ccaaggtcatgtgaaacta/pmc11072394-153-4-15
Average 90 stars, based on 1 article reviews
p70s6k sirna (gacggggtcctcaaatgta, ccaaggtcatgtgaaacta - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
sirnas targeting sur1, p70s6k, khsrp, and mettl1, let-7a-5p mimic and inhibitor  (Shanghai GenePharma)
90
Shanghai GenePharma sirnas targeting sur1, p70s6k, khsrp, and mettl1, let-7a-5p mimic and inhibitor
B3galt5 activates the mTOR pathway. (A) Immunoblot analysis of the phosphorylation of mTOR and <t>p70s6k</t> in liver extracts. The phosphorylation of mTOR and p70s6k in the indicated HCC cell lines with either b3galt5 knockdown or control siRNA (B) and with either b3galt5 overexpression or control vector (C) detected by western blotting
Sirnas Targeting Sur1, P70s6k, Khsrp, And Mettl1, Let 7a 5p Mimic And Inhibitor, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/egfp+sh+mettl1+plasmid/pm35240233-65-10-19
Average 90 stars, based on 1 article reviews
sirnas targeting sur1, p70s6k, khsrp, and mettl1, let-7a-5p mimic and inhibitor - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
p70s6k sirna  (Qiagen)
90
Qiagen p70s6k sirna
B3galt5 activates the mTOR pathway. (A) Immunoblot analysis of the phosphorylation of mTOR and <t>p70s6k</t> in liver extracts. The phosphorylation of mTOR and p70s6k in the indicated HCC cell lines with either b3galt5 knockdown or control siRNA (B) and with either b3galt5 overexpression or control vector (C) detected by western blotting
P70s6k Sirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/s6k2+sirna/pm34537439-128-0-5
Average 90 stars, based on 1 article reviews
p70s6k sirna - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
p70s6k 6566 knockdown  (Cell Signaling Technology Inc)
92
Cell Signaling Technology Inc p70s6k 6566 knockdown
B3galt5 activates the mTOR pathway. (A) Immunoblot analysis of the phosphorylation of mTOR and <t>p70s6k</t> in liver extracts. The phosphorylation of mTOR and p70s6k in the indicated HCC cell lines with either b3galt5 knockdown or control siRNA (B) and with either b3galt5 overexpression or control vector (C) detected by western blotting
P70s6k 6566 Knockdown, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/SignalSilence+p70%2F85+S6+Kinase+siRNA+I/pm33609687-59-3-24
Average 92 stars, based on 1 article reviews
p70s6k 6566 knockdown - by Bioz Stars, 2026-11
92/100 stars
  Buy from Supplier
p70s6k  (Cell Signaling Technology Inc)
92
Cell Signaling Technology Inc p70s6k
List of primary antibodies, their sources and dilutions
P70s6k, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/SignalSilence+cdc2+siRNA+I/pmc07023992-28-0-2
Average 92 stars, based on 1 article reviews
p70s6k - by Bioz Stars, 2026-11
92/100 stars
  Buy from Supplier
sirnas targeting mtor and p70s6k  (Shanghai GenePharma)
90
Shanghai GenePharma sirnas targeting mtor and p70s6k
List of primary antibodies, their sources and dilutions
Sirnas Targeting Mtor And P70s6k, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/plasmids/pm30339792-77-4-8
Average 90 stars, based on 1 article reviews
sirnas targeting mtor and p70s6k - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
p70s6k sirna pools that target 5ʹ-ccaaggucaugugaaacua-3ʹ; 5ʹ-cauggaacauugugagaaa-3ʹ; 5ʹ-gacaaaauccucaaaugua-3ʹ; 5ʹ-gcaggaguguuugacauag-3ʹ  (Thermo Fisher)
90
Thermo Fisher p70s6k sirna pools that target 5ʹ-ccaaggucaugugaaacua-3ʹ; 5ʹ-cauggaacauugugagaaa-3ʹ; 5ʹ-gacaaaauccucaaaugua-3ʹ; 5ʹ-gcaggaguguuugacauag-3ʹ
List of primary antibodies, their sources and dilutions
P70s6k Sirna Pools That Target 5ʹ Ccaaggucaugugaaacua 3ʹ; 5ʹ Cauggaacauugugagaaa 3ʹ; 5ʹ Gacaaaauccucaaaugua 3ʹ; 5ʹ Gcaggaguguuugacauag 3ʹ, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/pmc07295111-76-18-33
Average 90 stars, based on 1 article reviews
p70s6k sirna pools that target 5ʹ-ccaaggucaugugaaacua-3ʹ; 5ʹ-cauggaacauugugagaaa-3ʹ; 5ʹ-gacaaaauccucaaaugua-3ʹ; 5ʹ-gcaggaguguuugacauag-3ʹ - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
sirna pools that targeted p70s6k  (Shanghai GenePharma)
90
Shanghai GenePharma sirna pools that targeted p70s6k
List of primary antibodies, their sources and dilutions
Sirna Pools That Targeted P70s6k, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/plasmids/pm31341030-81-4-45
Average 90 stars, based on 1 article reviews
sirna pools that targeted p70s6k - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
sirna oligonucleotides against p70s6k  (Cell Signaling Technology Inc)
90
Cell Signaling Technology Inc sirna oligonucleotides against p70s6k
List of primary antibodies, their sources and dilutions
Sirna Oligonucleotides Against P70s6k, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/p70s6k+sirna/anti+p70s6k/10__1097_slash_wnr__0000000000001156-46-12-36
Average 90 stars, based on 1 article reviews
sirna oligonucleotides against p70s6k - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier

Image Search Results


B3galt5 activates the mTOR pathway. (A) Immunoblot analysis of the phosphorylation of mTOR and p70s6k in liver extracts. The phosphorylation of mTOR and p70s6k in the indicated HCC cell lines with either b3galt5 knockdown or control siRNA (B) and with either b3galt5 overexpression or control vector (C) detected by western blotting

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: B3galt5 deficiency attenuates hepatocellular carcinoma by suppressing mTOR/p70s6k-mediated glycolysis

doi: 10.1007/s00018-022-04601-x

Figure Lengend Snippet: B3galt5 activates the mTOR pathway. (A) Immunoblot analysis of the phosphorylation of mTOR and p70s6k in liver extracts. The phosphorylation of mTOR and p70s6k in the indicated HCC cell lines with either b3galt5 knockdown or control siRNA (B) and with either b3galt5 overexpression or control vector (C) detected by western blotting

Article Snippet: B3galt5 siRNA (GGGCATAGAATGGGTCCATTT, GCAAGTGGTTTGTCAGTAATT), p70s6k siRNA (GACGGGGTCCTCAAATGTA, CCAAGGTCATGTGAAACTA), and scramble siRNA (GATCATACGTGCGATCAGA) were purchased from RiboBio (Guangzhou, China).

Techniques: Western Blot, Over Expression, Plasmid Preparation

B3galt5 promotes glycolysis by regulating the mTOR /p70s6k pathway. (A) Western blotting analysis of key glycolytic enzymes in HLE cells expressing control siRNA or b3galt5 siRNA treated with the p70s6k activator 3BDO. (B, C) Western blotting analysis of key glycolytic enzymes in b3galt5-overexpressing HCC cell lines treated with the p70s6k inhibitor PF4708671. (D–F) Analysis of ECAR in b3galt5-overexpressing HCC cell lines treated with p70s6k siRNA using the Seahorse XFe 96 Analyzer. (G, H) Analysis of ECAR in HCC cell lines expressing b3galt5 siRNA transfected with p70s6k overexpression lentivirus using the Seahorse XFe 96 Analyzer. *p < 0.05, **p < 0.01, ***p < 0.001

Journal: Cellular and Molecular Life Sciences: CMLS

Article Title: B3galt5 deficiency attenuates hepatocellular carcinoma by suppressing mTOR/p70s6k-mediated glycolysis

doi: 10.1007/s00018-022-04601-x

Figure Lengend Snippet: B3galt5 promotes glycolysis by regulating the mTOR /p70s6k pathway. (A) Western blotting analysis of key glycolytic enzymes in HLE cells expressing control siRNA or b3galt5 siRNA treated with the p70s6k activator 3BDO. (B, C) Western blotting analysis of key glycolytic enzymes in b3galt5-overexpressing HCC cell lines treated with the p70s6k inhibitor PF4708671. (D–F) Analysis of ECAR in b3galt5-overexpressing HCC cell lines treated with p70s6k siRNA using the Seahorse XFe 96 Analyzer. (G, H) Analysis of ECAR in HCC cell lines expressing b3galt5 siRNA transfected with p70s6k overexpression lentivirus using the Seahorse XFe 96 Analyzer. *p < 0.05, **p < 0.01, ***p < 0.001

Article Snippet: B3galt5 siRNA (GGGCATAGAATGGGTCCATTT, GCAAGTGGTTTGTCAGTAATT), p70s6k siRNA (GACGGGGTCCTCAAATGTA, CCAAGGTCATGTGAAACTA), and scramble siRNA (GATCATACGTGCGATCAGA) were purchased from RiboBio (Guangzhou, China).

Techniques: Western Blot, Expressing, Transfection, Over Expression

List of primary antibodies, their sources and dilutions

Journal: Experimental hematology

Article Title: Panobinostat and venetoclax enhance the cytotoxicity of gemcitabine, busulfan, and melphalan in multiple myeloma cells

doi: 10.1016/j.exphem.2020.01.003

Figure Lengend Snippet: List of primary antibodies, their sources and dilutions

Article Snippet: P70S6K , Cell Signaling/2708 , Rabbit , 3500.

Techniques: